NEXTflex® PCR-Free Barcodes

For multiplexing Illumina amplification-free libraries

Catalog# Product Name Quantity US List Price
NOVA-514110 NEXTflex® PCR-Free Barcodes - 6 48 rxns $466 Buy Now
NOVA-514111 NEXTflex® PCR-Free Barcodes - 12 96 rxns $919 Buy Now
NOVA-514112 NEXTflex® PCR-Free Barcodes - 24 192 rxns $1,821 Buy Now
NOVA-514113 NEXTflex® PCR-Free Barcodes - 48 384 rxns $3,582 Buy Now

 

  • 6 nt index contained within adapter sequence eliminates the need to perform PCR to add flow cell binding sequences
  • Up to 48 multiplexed samples (up to 384 reactions per kit)
  • Compatible with NEXTflex PCR-Free DNA Sequencing Kit
  • Considerably reduce your per-sample sequencing cost by barcoded multiplexing
  • Increase your sequencing scale by pooling 100s of samples on a single flow cell
  • Compatible with Illumina Next-Generation Sequencing platforms

 

NEXTflex™ PCR-Free Barcodes are barcoded adapters for multiplexing Illumina libraries which provide flexibility and high-throughput capabilities in sequencing applications. They significantly increase scale while reducing costs by allowing the user to pool multiple library preparations in a single flow cell lane. The NEXTflex PCR-Free Barcodes accomplish this by using an indexed adapter with a 6 nt unique sequence. This allows for proper differentiation between samples, preventing poor reads caused by single base errors introduced during PCR. The NEXTflex index is contained within the adapter sequence, eliminating the need to perform PCR to add flow cell binding sequences.

These barcodes can be used with single, paired-end, and multiplex reads and are compatible with the NEXTflex PCR-Free Sequencing Kits and other PCR-Free DNA library prep protocols.


Selected Publications that Reference Using the NEXTflex PCR-Free DNA Barcodes

Bartoli, C., Carrere, S., Lamichhane, J. R., Varvaro, L. and Cindy E. Morris, C.  E. (2015) Genome Sequencing of 10 Pseudomonas syringae Strains Representing Different Host Range Spectra. Genome Announc. 3: e00379-15.

Chusova, O, et al. (2014) Effect of pine bark on the biotransformation of trinitrotoluene and on the bacterial community structure in a batch experiment. Ecological Technology. Vol. 35, Issue 19.

Chusova, O. et al. (2015) Biotransformation of pink water TNT on the surface of a low-cost adsorbent pine bar. Biodegradation. 1 – 12.

Evrony, Cai, et al. (2012) Single-Neuron Sequencing Analysis of L1 Retrotransposition and Somatic Mutation in the Human Brain. Cell. Vol. 151, Issue 3, pp. 483-496.

Hasbún, R., Iturra, C., Bravo, S., Rebolledo-Jaramillo, B. and Valledor, L. (2016) Differential Methylation of Genomic Regions Associated with Heteroblasty Detected by M&M Algorithm in the Nonmodel Species Eucalyptus globulus Labill. International Journal of Genomics. 4395153. doi: 10.1155/2016/4395153.

Kawahara-Miki R., Sano S., Nunome M. et al. (2013) Next-generation sequencing reveals genomic features in the Japanese quail. Genomics. DOI: 10.1016/j.ygeno.2013.03.006.

Kocher, A., et al. (2016) Vector soup: high-throughput identification of neotropical phlebotomine sand flies using metabarcoding. Molecular Ecology Resources. doi:10.1111/1755-0998.12556.

Kofler, R., Nolte, V. and Schlötterer, C. (2015) Tempo and Mode of Transposable Element Activity in Drosophila. PLOS Genetics. doi: 10.1371/journal.pgen.1005406.

Kofler, R., Nolte, V. and Schlötterer, C. (2015) The impact of library preparation protocols on the consistency of allele frequency estimates in Pool-Seq data. Molecular Ecology Resources. doi: 10.1111/1755-0998.12432.

Ligi, T, et al. (2013) Characterization of bacterial communities in soil and sediment of a created riverine wetland complex using high-throughput 16S rRNA amplicon sequencing. Ecological Engineering. DOI: 10.1016/j.ecoleng.2013.09.007.

Mändar, R. et al. (2015) Complementary seminovaginal microbiome in couples. Research in Microbiology. doi:10.1016/j.resmic.2015.03.009.

Mathys J., Vos C. et al. (2013) RNAseq-based transcriptome analysis of Lactuca sativa infected by the fungal necrotroph Botrytis cinerea. Plant, Cell & Environment. DOI: 10.1111/pce.12106.

Mazueta, C., Bouchierb, C. and Popoffadoi, M. R. (2015) Draft Genome Sequence of Clostridium botulinum Strain 277-00 Type B2. Genome Announc. 3:2 e00211-15. doi: 10.1128/genomeA.00211-15.

 

Petersen, G., et al. (2015) Phylogeny of the Alismatales (Monocotyledons) and the relationship of Acorus (Acorales?). Cladistics. doi: 10.1111/cla.12120.

Sato S, Sesay AK, Holder AA (2013) The Unique Structure of the Apicoplast Genome of the Rodent Malaria Parasite Plasmodium chabaudi chabaudi. PLoS ONE 8(4): e61778. doi:10.1371/journal.pone.0061778.

Smidt, I., et al. (2015) Comparison of detection methods for vaginal lactobacilli. Beneficial Microbes. In press.

Suzuki, S, et al. (2014) Physiological and genomic features of highly alkaliphilic hydrogen-utilizing Betaproteobacteria from a continental serpentinizing site. Nature Communications 5, (3900).

Tiirik, K, et al., (2014) Characterization of the bacterioplankton community and its antibiotic resistance genes in the Baltic Sea. Biotechnology and Applied Biochemistry. Vol. 61, Issue 1, pp. 23–33.

Won, HH, et al. (2013) Detecting somatic genetic alterations in tumor specimens by exon capture and massively parallel sequencing. J. Vis. Exp. (80), e50710, doi:10.3791/50710.


Kit Specs

The NEXTflex™ PCR-Free Barcodes Kits contains 6, 12, 24 or 48 unique barcodes, enabling the user to multiplex up to 48 samples per flow cell lane. These kits ship on dry ice.

Kit Contents

NEXTflex™ PCR-Free Barcode Adapter (50 µM)

 

Required Materials Not Provided

 

500 ng to 3 µg of fragmented genomic DNA in up to 40 µL nuclease-free water.
NEXTflex™ PCR-Free DNA Sequencing Kit– 8 / 48 (Cat # 5142-01, 5142-02)
Ethanol 80% (room temperature)
96-well PCR Plate Non-skirted (Phenix Research, Cat # MPS-499) / or / similar
96-well Library Storage and Pooling Plate (Fisher Scientific, Cat # AB-0765) / or / similar
Adhesive PCR Plate Seal (BioRad, Cat # MSB1001)
Agencourt AMPure XP 5 mL (Beckman Coulter Genomics, Cat # A63880)
Magnetic Stand -96 (Ambion, Cat # AM10027) / or / similar
Heat block
Thermocycler
2, 10, 20, 200 and 1000 µL pipettes / multichannel pipettes
Nuclease-free barrier pipette tips
Microcentrifuge
1.5 mL nuclease-free microcentrifuge tubes
Vortex
qPCR Library Quantification Kit / or / the following components:
qPCR Dilution Buffer: 10 mM Tris HCl pH 8.0, 0.05% Tween 20
Control Templates
qPCR Primer 1 - HPLC Purified - 5’AATGATACGGCGACCACCGA -3’
qPCR Primer 2 - HPLC Purified - 5’CAAGCAGAAGACGGCATACGA -3’

 

What is the concentration of the NEXTflex PCR-Free DNA Barcodes?

The NEXTflex PCR-Free DNA Barcodes concentration is 50 µM.

 

Do the NEXTflex PCR-Free DNA Barcodes Kits contain PCR primers?

No, these barcodes are not supplied with PCR primers are they are designed to be used with the NEXTflex PCR-Free DNA-Seq Kit.

 

How is the quality of the NEXTflex PCR-Free DNA Barcodes ensured?

Each lot of the NEXTflex PCR-Free DNA Barcodes are sequence verified on an Illumina MiSeq.

 

What type of purification is used when the NEXTflex PCR-Free DNA Barcodes are synthesized?

The NEXTflex Barcodes are HPLC-purified to ensure high quality sequencing data is obtained. HPLC-purified barcodes minimize the risk of mispriming events due to truncations and other errors that may compromise sequencing data quality.