NEXTflex™ PCR-Free DNA Library Prep Kit for Illumina

Amplification-free DNA library prep for sequencing on Illumina platforms

Catalog# Product Name Quantity US List Price
5142-01 NEXTflex™ PCR-Free DNA Sequencing Kit 8 rxns $406 Buy Now
5142-02 NEXTflex™ PCR-Free DNA Sequencing Kit 48 rxns $1,884 Buy Now
514110 NEXTflex™ PCR-Free DNA Barcodes - 6 48 rxns $466 Buy Now
514111 NEXTflex™ PCR-Free DNA Barcodes - 12 96 rxns $919 Buy Now
514112 NEXTflex™ PCR-Free DNA Barcodes - 24 192 rxns $1,821 Buy Now
514113 NEXTflex™ PCR-Free DNA Barcodes - 48 384 rxns $3,582 Buy Now
514012 Agarose Gel Size Selection Kit 10 gel isolations $35 Buy Now
514013 Agarose Gel Size Selection Kit 50 gel isolations $157 Buy Now

NEXTflex PCR-Free DNA Library Prep Kit for Illumina Sequencing
  • Eliminates amplification bias and poor sequence representation
  • Improves read mapping
  • Reduces duplicate sequences
  • Better de novo assembly
  • As little as 500 ng of input DNA needed
  • Enhanced adapter ligation technology with NEXTflex™ Ligation
  • Flexible barcode options - NEXTflex PCR-Free Barcode kits contain 6, 12, 24, or 48 unique barcodes
  • Bead-based cleanup protocol
  • Automation-friendly workflow is compatible with liquid handlers
  • Barcoded adapters for multiplexing contain embedded index sequence

Amplifying AT or GC rich genomic regions often leads to sequence biased nucleotide compositions and poses a serious challenge during analysis. Using specially designed master-mixed enzymes, the NEXTflex™ PCR-Free DNA Library Prep Kit completely eliminates the need for amplification, enabling better read mapping and a reduction in duplicate sequences, leading to reduced sequence cost and bias, for more representative base identities and better de novo assembly.

In addition, the NEXTflex PCR-Free DNA Sequencing Kit features patent pending Enhanced Adapter Ligation Technology, resulting in library preps with a larger number of unique sequencing reads. With these improvements to the ligation enzymatic mix, the user will now have the ability to perform ligations with longer adapters, and can expect to see better binding efficiencies. The NEXTflex PCR-Free Sequencing Kit simplifies workflow by using master mixed reagents and magnetic bead based cleanup, reducing pipetting and eliminating time consuming steps in library preparation.


Exceptional Multiplexing Capabilities  

Using the NEXTflex™ PCR-Free Barcodes, the user can index 6, 12, 24, or 48 samples at once providing exceptional sequencing capacity.

The NEXTflex PCR-Free DNA Sequencing Kit is designed to prepare gel-free libraries using magnetic bead based size selection from as little as 500 ng of input DNA. If you have specific insert size requirements and would like to perform agarose gel size selection, we recommend the NEXTflex™ Agarose Gel Size Selection Kit.

Download a copy of our Application Note, Tools for Enhanced Sequence Diversity and Reducing Bias in DNA-seq Library Preparation, for more information about this kit.


Automation Solutions

The NEXTflex PCR-Free DNA Sequencing Kit and NEXTflex PCR-Free Modules are automated on the Tecan Freedom EVO Workstation. For more information about this customer developed automation solution read Tecan’s article, GeT with the NGS program, published in the Tecan Journal.

For larger volume requirements, customization and bulk packaging is available. For increased flexibility individual reagents (non-master mixed) are also available. Please contact nextgen@biooscientific.com for further information. 


Selected Publications that Reference Using the NEXTflex PCR-Free DNA-Seq Kit: 

Bartoli, C., Carrere, S., Lamichhane, J. R., Varvaro, L. and Cindy E. Morris, C.  E. (2015) Genome Sequencing of 10 Pseudomonas syringae Strains Representing Different Host Range Spectra. Genome Announc. 3: e00379-15.

Chusova, O, et al. (2014) Effect of pine bark on the biotransformation of trinitrotoluene and on the bacterial community structure in a batch experiment. Ecological Technology. Vol. 35, Issue 19.

Chusova, O. et al. (2015) Biotransformation of pink water TNT on the surface of a low-cost adsorbent pine bar. Biodegradation. 1 – 12.

Evrony, Cai, et al. (2012) Single-Neuron Sequencing Analysis of L1 Retrotransposition and Somatic Mutation in the Human Brain. Cell. Vol. 151, Issue 3, pp. 483-496.

Hasbún, R., Iturra, C., Bravo, S., Rebolledo-Jaramillo, B. and Valledor, L. (2016) Differential Methylation of Genomic Regions Associated with Heteroblasty Detected by M&M Algorithm in the Nonmodel Species Eucalyptus globulus Labill. International Journal of Genomics. 4395153. doi: 10.1155/2016/4395153.

Kawahara-Miki R., Sano S., Nunome M. et al. (2013) Next-generation sequencing reveals genomic features in the Japanese quail. Genomics. DOI: 10.1016/j.ygeno.2013.03.006.

Kocher, A., et al. (2016) Vector soup: high-throughput identification of neotropical phlebotomine sand flies using metabarcoding. Molecular Ecology Resources. doi:10.1111/1755-0998.12556.

Kofler, R., Nolte, V. and Schlötterer, C. (2015) Tempo and Mode of Transposable Element Activity in Drosophila. PLOS Genetics. doi: 10.1371/journal.pgen.1005406.

Kofler, R., Nolte, V. and Schlötterer, C. (2015) The impact of library preparation protocols on the consistency of allele frequency estimates in Pool-Seq data. Molecular Ecology Resources. doi: 10.1111/1755-0998.12432.

Ligi T, et al. (2013) Characterization of bacterial communities in soil and sediment of a created riverine wetland complex using high-throughput 16S rRNA amplicon sequencing. Ecological Engineering. DOI: 10.1016/j.ecoleng.2013.09.007.

Mändar, R. et al. (2015) Complementary seminovaginal microbiome in couples. Research in Microbiology. doi:10.1016/j.resmic.2015.03.009.

Mazueta, C., Bouchierb, C. and Popoffadoi, M. R. (2015) Draft Genome Sequence of Clostridium botulinum Strain 277-00 Type B2. Genome Announc. 3:2 e00211-15. doi: 10.1128/genomeA.00211-15.

Petersen, G., et al. (2015) Phylogeny of the Alismatales (Monocotyledons) and the relationship of Acorus (Acorales?). Cladistics. doi: 10.1111/cla.12120.

Sato S, Sesay AK, Holder AA (2013) The Unique Structure of the Apicoplast Genome of the Rodent Malaria Parasite Plasmodium chabaudi chabaudi. PLoS ONE 8(4): e61778. doi:10.1371/journal.pone.0061778.

Smidt, I., et al. (2015) Comparison of detection methods for vaginal lactobacilli. Beneficial Microbes. In press.

Suzuki, S, et al. (2014)Physiological and genomic features of highly alkaliphilic hydrogen-utilizing Betaproteobacteria  from a continental serpentinizing site. Nature Communications 5, (3900).

Tiirik, K, et al., (2014) Characterization of the bacterioplankton community and its antibiotic resistance genes in the Baltic Sea. Biotechnology and Applied Biochemistry. Vol. 61, Issue 1, pp. 23–33.


Kit Specs

The NEXTflex PCR-Free DNA Sequencing Kits contain the reagents to prepare 8 or 48 genomic DNA samples (0.5 - 3 µg) for Illumina®-compatible next-generation sequencing. The shelf life of all reagents is 12 months when stored properly at -20°C. Ships on dry ice.

NEXTflex™ PCR-Free DNA-Seq Protocol

 

NEXTflex Illumina PCR-Free DNA Seq Library Prep Kit

How should PCR-free libraries be quantified?

PCR-free libraries should be quantified using qPCR. qPCR quantification is necessary because the final library will have a mixture of doubly-ligated, singly-ligated, and unligated products, and only the doubly-ligated products will be able to generate clusters efficiently on the flow cell.

What sequencing platforms is this kit compatible with?

This kit is compatible with all common Illumina sequencing platforms including HiSeq, MiSeq, and NextSeq 500 systems.

How many barcodes (indices) are available for the NEXTflex PCR-Free kit?

48 barcodes are available as NEXTflex PCR-Free Barcodes. For input amounts of 1 µg or less NEXTflex-96 DNA Barcodes may be used instead, which have 96 available barcodes.

My library does not run as expected on a gel or Bioanalyzer. Why is this?

The Y-shaped nature of unamplified barcoded adapters often causes products to migrate at a slightly higher molecular weight than expected. This is normal and should not affect the performance of the libraries. 

 

Kit Contents

NEXTflex™ PCR-Free End Repair Buffer Mix
NEXTflex™ PCR-Free End Repair Enzyme Mix
NEXTflex™ PCR-Free Adenylation Mix
NEXTflex™ PCR-Free Ligation Mix
NEXTflex™ PCR-Free DNA Adapter (50 µM)
Nuclease-free Water
Resuspension Buffer

 

Required Materials Not Provided

500 ng to 3 µg of fragmented genomic DNA in up to 40 µL nuclease-free water.
NEXTflex™ PCR-Free Barcodes – 6 / 12 / 24 / 48 (Cat # 514110, 514111, 514112, 514113)  
Ethanol 80% (room temperature)
96-well PCR Plate Non-skirted (Phenix Research, Cat # MPS-499) / or / similar
96-well Library Storage and Pooling Plate (Fisher Scientific, Cat # AB-0765) / or / similar
Adhesive PCR Plate Seal (BioRad, Cat # MSB1001)
Agencourt AMPure XP 5 mL (Beckman Coulter Genomics, Cat # A63880)
Magnetic Stand -96 (Ambion, Cat # AM10027) / or / similar
Heat block
Thermocycler
2, 10, 20, 200 and 1000 µL pipettes / multichannel pipettes
Nuclease-free barrier pipette tips
Microcentrifuge
1.5 mL nuclease-free microcentrifuge tubes
Vortex
qPCR Library Quantification Kit / or / the following components:
qPCR dilution buffer: 10 mM Tris HCl pH 8.0, 0.05% Tween 20
Control Templates
qPCR Primer 1 - HPLC Purified - 5’AATGATACGGCGACCACCGA -3’
qPCR Primer 2 - HPLC Purified - 5’CAAGCAGAAGACGGCATACGA -3’